View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_low_37 (Length: 221)
Name: NF7691_low_37
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 33026099 - 33026300
Alignment:
| Q |
1 |
tttgcgtttatgtgtcaattttatgtgtttggaaatattttgacagaaatcaaaagaaatgggtgattggaaaattgagattacttgacgtgtatacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026099 |
tttgcgtttatgtgtcaattttatgtgtttggaaatattttgacagaaatcaaaagaaatgggtgattggaaaattgagattacttgacgtgtatacata |
33026198 |
T |
|
| Q |
101 |
accgatgaaataaagtgacaatattgcttgtgttaatgaagaggtgaacgtggcctatcttgctttgcacatatgctgtgattagtgctgtgtgtggtcc |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026199 |
accgatgaaaaaaagtgacaatattgcttgtgttaatgaagaggtgaacgtggcctatcttgctttgcacatatgctgtgattagtgctgtgtgtggtcc |
33026298 |
T |
|
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
33026299 |
at |
33026300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University