View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7691_low_38 (Length: 209)

Name: NF7691_low_38
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7691_low_38
NF7691_low_38
[»] chr4 (1 HSPs)
chr4 (13-194)||(39828440-39828622)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 39828622 - 39828440
Alignment:
13 cagagaaaatggatacattccaaagagagtggatggggaccaaggagatgtggaaagtgataattattgtggatnnnnnnn-cttaagtacgttttggac 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||    
39828622 cagagaaaatggatacattccaaagagagtggatggggaccaaggagatgtggaaagtgataattattgtggataaaaaaaacttaagtacgttttggac 39828523  T
112 cagggattatcatataatttgttttgtctgtttcatcatttgaacctagatgtaacgatggaggttaagttaattaatcaaag 194  Q
    |||||||| |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
39828522 cagggattctcatataatttgttttgtctgttctatcatttgaacctagatgtaacgatggaggttaagttaattaatcaaag 39828440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University