View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_low_6 (Length: 527)
Name: NF7691_low_6
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 213 - 506
Target Start/End: Original strand, 1193790 - 1194083
Alignment:
| Q |
213 |
tagtaatctaagaaatcttgcattatcctgtttcttttgtggtttattgtaattattggtggttagctgacaaatttgaaaggnnnnnnnctcaaatttt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1193790 |
tagtaatctaagaaatcttgcattatcctgtttcttttgtggtttattgtaattattggtggttagctgacaaatttgaaaggaaaaaaactcaaatttt |
1193889 |
T |
 |
| Q |
313 |
atatttttcaagttggatatgtgtccaattgcgcatgaattttgcaaaattttcatggcaaaatggaaataatttaatacttctcgatatat-aaccaaa |
411 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1193890 |
atatttttcatgttggatatgtgtccaattgcgcatgaa--ttgcaaaattttcatggcaaaatggaaataatttaatacttctcgatatataaaccaaa |
1193987 |
T |
 |
| Q |
412 |
aatttagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcactatgac-tttgtaaatatttt |
506 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1193988 |
aattcagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcaatatgacttttgtaaatatttt |
1194083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University