View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7693_high_13 (Length: 257)
Name: NF7693_high_13
Description: NF7693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7693_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 110 - 246
Target Start/End: Complemental strand, 47936007 - 47935871
Alignment:
| Q |
110 |
aataataacgtgtcttttagattattcacatatttttattgaactattttaatcactcaatatctggtactcgatcagtaaaattcagaaaaacatttag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47936007 |
aataataacgtgtcttttagattattcacatatttttattgaactattttaatcactcaatatctggtattcgatcagtaaaattcagaaaaacatttag |
47935908 |
T |
|
| Q |
210 |
tacgtagctgcaatgtttctagtaaaatgattttctt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47935907 |
tacgtagctgcaatgtttctagtaaaatgattttctt |
47935871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 47941066 - 47940997
Alignment:
| Q |
15 |
caaatagccacagagttttcacttggttctaccgtggaaccttattcagccaggtttaaccaacaatatg |
84 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47941066 |
caaatagccacagagtttgcacttggttctacagtggaaccttattcagccaggtttaaccaacaatatg |
47940997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 115
Target Start/End: Complemental strand, 47947113 - 47947013
Alignment:
| Q |
15 |
caaatagccacagagttttcacttggttctaccgtggaaccttattcagccaggtttaaccaacaatatgaactccacgtcggaatattttgggtaataa |
114 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||| | |||||||||| | ||||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
47947113 |
caaatagcctcagagatagcacttggttctaccgtaggaccttattcatctcagtttaaccaacaatatgaaatcaacgttggaatattttgggtaataa |
47947014 |
T |
|
| Q |
115 |
t |
115 |
Q |
| |
|
| |
|
|
| T |
47947013 |
t |
47947013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University