View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7693_high_15 (Length: 241)
Name: NF7693_high_15
Description: NF7693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7693_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 18024194 - 18024085
Alignment:
| Q |
18 |
caatcagcaccaagaaagtctttaataaccaaacttcctggctttagtggcattataccttccaagcactatgctgggtatgctattttgtttctctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18024194 |
caatcagcaccaagaaagtctttaataaccaaacttcctggcttcagtggtattataccttccaagcactatgctgggtatgctattttgtttctctaaa |
18024095 |
T |
 |
| Q |
118 |
aagattcttg |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
18024094 |
aagattcttg |
18024085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 173 - 241
Target Start/End: Complemental strand, 18024038 - 18023970
Alignment:
| Q |
173 |
agatgatatatagtcctactgttttcaacaattgaagtttgtttgaagcgactattgattctctctagc |
241 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18024038 |
agatgagatatagtcctaccgttttcaacgattgaagtttgtttggaacgactattgattctctctagc |
18023970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University