View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7693_high_8 (Length: 318)
Name: NF7693_high_8
Description: NF7693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7693_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 35096680 - 35096836
Alignment:
| Q |
1 |
agtgttaatttattttataataagttctcctttcatcaattttaaaattggaaaattgaattcatgcattcttccttttatatatggcagcaagaacccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35096680 |
agtgttaatttattttataataagttctcctttcatcaattttaaaattggaaaattgaattcatgcatgcttccttttatatatggcagcaagaacccg |
35096779 |
T |
 |
| Q |
101 |
gaactgtatgatcgacttgctaaaggccagtctcccaaggtgattaattattagatc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35096780 |
gaactgtatgatcgacttgctaaaggccagtctcccaaggtgattaattattagatc |
35096836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 240 - 301
Target Start/End: Original strand, 35096919 - 35096980
Alignment:
| Q |
240 |
cttgttccgactctcgagtgagtccctctgttatcctcaactttcaacctggtgaagctttc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35096919 |
cttgttccgactctcgagtgagtccctctgttatcctgaactttcaacctggtgaagctttc |
35096980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 60 - 152
Target Start/End: Original strand, 35109965 - 35110057
Alignment:
| Q |
60 |
attcatgcattcttccttttatatatggcagcaagaacccggaactgtatgatcgacttgctaaaggccagtctcccaaggtgattaattatt |
152 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||||| ||| | || |||||||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
35109965 |
attcattcatgcttccttttatatatgacagcaaggaccggaaattgtatgatcgacttgctaaaggacaatcccccaaggtgattaattatt |
35110057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 240 - 301
Target Start/End: Original strand, 35110159 - 35110220
Alignment:
| Q |
240 |
cttgttccgactctcgagtgagtccctctgttatcctcaactttcaacctggtgaagctttc |
301 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
35110159 |
cttgttctgactctagagtgagtccctctattatcctgaactttcaacctggagaagctttc |
35110220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 248 - 301
Target Start/End: Original strand, 35102818 - 35102871
Alignment:
| Q |
248 |
gactctcgagtgagtccctctgttatcctcaactttcaacctggtgaagctttc |
301 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||||||||| ||| ||||||||| |
|
|
| T |
35102818 |
gactctagagtgagtccctctattatcctgaactttcaacatggagaagctttc |
35102871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University