View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7693_low_11 (Length: 316)
Name: NF7693_low_11
Description: NF7693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7693_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 263
Target Start/End: Complemental strand, 28255642 - 28255403
Alignment:
| Q |
12 |
acatcatatgagagttatttacatgaaaagtaaaagctacccatgcaaggttattgtcttaaacattcttgagtgtatcacatcactagataaaaatatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28255642 |
acatcatatgagagttatttacatgaaaagtaaaaactacccatgcaaggttattgtcttaaacattcttgagtgtatcac-----tagataaaaatatg |
28255548 |
T |
 |
| Q |
112 |
gcctaaaatgtgattagaatttataagtgatgaacacttgtcacaaactcgattcaaattttaagatagtgttcaagtctttttctagattcatcaagtc |
211 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28255547 |
gcctaaaatgtggtta-------taaatgatgaacacttgtcacaaactcgattcaaattttaagatagtgttcaagtctttttctagattcatcaagtc |
28255455 |
T |
 |
| Q |
212 |
actcgagtcacattcaaggtgttagttgcgagtgtgtgttgtgatgtgtctc |
263 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28255454 |
actcgagtcacactcaaggtgttagttgcgagtgtgtgttgtgatgagtctc |
28255403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University