View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7694_high_11 (Length: 291)
Name: NF7694_high_11
Description: NF7694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7694_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 26734238 - 26734513
Alignment:
| Q |
1 |
ctccggtggagttccaccggagttaggttcaatcaaatctctccgatatcttgaaatttctaacgctaacctcaccggagaaattccaccgagtcttgga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734238 |
ctccggtggaattccaccggagttaggttcaatcaaatctctccgatatcttgaaatttctaacgctaacctcaccggagaaattccaccgagtcttgga |
26734337 |
T |
 |
| Q |
101 |
aatttagaaaacctcgactccttgtttttgcaaatgaacaacctcaccggaacaattccacccgaactctcttcaatgcggagtctcatgtcgttggatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734338 |
aatttagaaaacctcgactccttgtttttgcaaatgaacaacctcaccggaacaattccacccgaactctcttcaatgcggagtctcatgtcgttggatc |
26734437 |
T |
 |
| Q |
201 |
tctccatcaacggactctcaggggagattccagaaaccttctcaaagctgaaaaatctcactctcatcaatttctt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734438 |
tctccatcaacggactctcaggggagattccagaaaccttctcaaagctgaaaaatctcactctcatcaatttctt |
26734513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 276
Target Start/End: Original strand, 26725926 - 26726199
Alignment:
| Q |
3 |
ccggtggagttccaccggagttaggttcaatcaaatctctccgatatcttgaaatttctaacgctaacctcaccggagaaattccaccgagtcttggaaa |
102 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26725926 |
ccggtggaattccaccggagttcggttcaatcaaatctctccgatatctggacatttctaactctaacctcaccggagaaattccaccgagtcttggaaa |
26726025 |
T |
 |
| Q |
103 |
tttagaaaacctcgactccttgtttttgcaaatgaacaacctcaccggaacaattccacccgaactctcttcaatgcggagtctcatgtcgttggatctc |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
26726026 |
tttagaaaacctcgactacttgtttttgcaaatgaactacctcaccggaaaaattccacccgaactctcttcaatgcgaagtctcatgatgttggatctc |
26726125 |
T |
 |
| Q |
203 |
tccatcaacggactctcaggggagattccagaaaccttctcaaagctgaaaaatctcactctcatcaatttctt |
276 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
26726126 |
tccatcaacgaactctcaggggagattccagaaaccttctcaaagctgaaacatctcactcttatcaatttctt |
26726199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University