View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7694_high_14 (Length: 266)
Name: NF7694_high_14
Description: NF7694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7694_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 45324587 - 45324819
Alignment:
| Q |
18 |
cccgccatccctagaagcatgtttgcagtgactcctcgaaatagagctaagaaaccctcttgtccaacaatctcacgaaatgcatgcattgaattataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45324587 |
cccgccatccctagaagcatgtttgcagtgactcctcgaaatagagctaagaaaccctcttgtccaacaatctcacggaatgcatgcattgaattataat |
45324686 |
T |
|
| Q |
118 |
atttgttttggtgtccggaagttagcatcatacgccggcgtaatgtgtcaaaaggatatgcacagacaccagatacagttgtgatgctccaacctaacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45324687 |
atttgttttggtgtccggaagttagcatcatacgccggcgtaatgtgtcaaaaggatatgcacagacaccagatacagttgtgatgctccaacctaaaaa |
45324786 |
T |
|
| Q |
218 |
gaaactagcaaagaagttcccctgaagaaaata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45324787 |
gaaactagcaaagaagttcccctgaagaaaata |
45324819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University