View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7694_low_13 (Length: 285)
Name: NF7694_low_13
Description: NF7694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7694_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 70 - 139
Target Start/End: Complemental strand, 34361273 - 34361204
Alignment:
| Q |
70 |
tctggatcaatggcagttgtgaaggtataaggagtaacacaggcacctgatggtaaacatgatgagacag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34361273 |
tctggatcaatggcagttgtgaaggtataaggagtaacacaggcacctgatggtaaacatgatgaaacag |
34361204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 266
Target Start/End: Complemental strand, 34360878 - 34360846
Alignment:
| Q |
234 |
tataccctgaaatgcatggttaacataattgtt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34360878 |
tataccctgaaatgcatggttaacataattgtt |
34360846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 66 - 140
Target Start/End: Complemental strand, 37167052 - 37166978
Alignment:
| Q |
66 |
cttctctggatcaatggcagttgtgaaggtataaggagtaacacaggcacctgatggtaaacatgatgagacaga |
140 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||| |||||||||| || |||||||||| |
|
|
| T |
37167052 |
cttctctagatcaatggcagttgtgatggtataaggaggaacacaggcacgtgatggtaaatataatgagacaga |
37166978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 66 - 140
Target Start/End: Original strand, 12118356 - 12118430
Alignment:
| Q |
66 |
cttctctggatcaatggcagttgtgaaggtataaggagtaacacaggcacctgatggtaaacatgatgagacaga |
140 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||| |||||||||| || |||| ||||| |
|
|
| T |
12118356 |
cttctctagatcaatggcagttgtgatggtataaggaggaacacaggcacgtgatggtaaatataatgaaacaga |
12118430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 219 - 266
Target Start/End: Complemental strand, 25291434 - 25291387
Alignment:
| Q |
219 |
atgaatttcaacagctataccctgaaatgcatggttaacataattgtt |
266 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
25291434 |
atgaatttcaacagctataccatgaaatacatagttaacataattgtt |
25291387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University