View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7694_low_6 (Length: 394)
Name: NF7694_low_6
Description: NF7694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7694_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 350
Target Start/End: Complemental strand, 13276683 - 13276347
Alignment:
| Q |
17 |
ttacaaggtaaaaggcataatg----tacacatttgaaaattaaagtggagaaaacttaacacagggtgtagtcttccactggtgggactagaaagagac |
112 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| || |||| ||||||||| ||||||| || ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13276683 |
ttacaaggtaaaaggcataatggatgtacatatttataagttaaggtggagaaagcttaacatagagtg-agtcttccactagtgggactagaaagagac |
13276585 |
T |
|
| Q |
113 |
taccaatggtagcnnnnnnntggtacaattagggagcccttttgtgttatgctttaggcgagagcaagaaattctttaagaggacggaatgcgttctagg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
13276584 |
taccaatggtagcaaaaaaatggtacaattagggagtccttctgtgttatgctttaggcgagagcaagaaattctttaagaggacgaaatgtgttctagg |
13276485 |
T |
|
| Q |
213 |
ggttaaaggaggtatgaaacaacttatgtgattaactcaaagttaaaggtaatttgaggcaagtgggtattcaagagaacaaaggtaaggtgaagacttg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||| |||||| ||| |
|
|
| T |
13276484 |
ggttaaaggaggtatgaaacaacttatgggattaactcaaagttaaaggtaatttgaggtaagtggatattgaagagaacaaaggtaagatgaagatttg |
13276385 |
T |
|
| Q |
313 |
ttatatatgccttggaataacaatatttgcaaaagtct |
350 |
Q |
| |
|
|| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
13276384 |
ttgtatatgccttggaatatcattatttgcaaaagtct |
13276347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University