View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7695_low_5 (Length: 261)
Name: NF7695_low_5
Description: NF7695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7695_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 28 - 225
Target Start/End: Complemental strand, 42125940 - 42125735
Alignment:
| Q |
28 |
tggaacacatatgtctcttgcctcaaaaatatgcaagctacgtgatcttca-------caagaaccacagatatcataaggtgttaacacctttcatact |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42125940 |
tggaacacatatgtctcttgcctcaaaaatatgcgagctacatgatcttcattcttcacaagaaccacagatattataaggtgttaacacctttcatact |
42125841 |
T |
|
| Q |
121 |
cataatcgtctctcgaactaaaaaa-catagtaatttctggaattatcccaaattcaggttcttgaaatattttaatttgatttcaaattaatttttatc |
219 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125840 |
cataatcgtctctcgacctaaaaaaacatagtaatttctggaattatcccaaattcaggttcttgaaatattttaatttgatttcaaattaatttttatc |
42125741 |
T |
|
| Q |
220 |
atcgtt |
225 |
Q |
| |
|
|||||| |
|
|
| T |
42125740 |
atcgtt |
42125735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University