View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7695_low_6 (Length: 239)
Name: NF7695_low_6
Description: NF7695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7695_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 24137388 - 24137165
Alignment:
| Q |
1 |
aaactagtttttgataacatgctttataaggattccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaggaggctcgtcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24137388 |
aaactagtttttgataacatgctttataaggattccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaggaggctcgtcgat |
24137289 |
T |
|
| Q |
101 |
tgtttgagtcgaaggtggattgggaattgatttcgtggaattgtttgatgggtaggtatgtaaaaggaagatgttgggtgatgctattagactttttgat |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24137288 |
tgtttgagtcgaaggtggtttgggaattgattccgtggaattgtttgatgggtaggtatgtaagaggaagatgttgggtgatgctattagactttttgat |
24137189 |
T |
|
| Q |
201 |
catgtgcttgttagggatgtaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24137188 |
catgtgcttgttagggatgtaatt |
24137165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 24135066 - 24134854
Alignment:
| Q |
1 |
aaactagtttttgataacatgctttataaggatt-ccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaggaggctcgtcga |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| |||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24135066 |
aaactagtttttgataacatgccttataagtatttccatcttttggaatggattgcttgtagtgtatgttcaaaatgggagacttgaggaggctcgtcga |
24134967 |
T |
|
| Q |
100 |
ttgtttgagtcgaaggtggattgggaattgatttcgtggaattgtttgatgggtaggtatgt-aaaaggaagatgttgggtgatgctattagactttttg |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||| || |||| ||||||||||||||||| ||| |||||| |
|
|
| T |
24134966 |
-------------aggtggattgggaattgattttgtggaattgtttgatgggtaggaatgtgaagaggaggatgttgggtgatgctaggagattttttg |
24134880 |
T |
|
| Q |
199 |
atcatgtgcttgttagggatgtaatt |
224 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
24134879 |
atcatatgcttgttagggatgtaatt |
24134854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 45148511 - 45148726
Alignment:
| Q |
1 |
aaactagtttttgataacatgctttataaggattccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaggaggctcgtcgat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45148511 |
aaactagtttttgataacatgccttataaggattccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaagaggctcgtcgat |
45148610 |
T |
|
| Q |
101 |
tgtttgagtcgaaggtggattgggaattgatttcgtggaattgtttgatgggtaggtatgt-aaaaggaagatgttgggtgatgctattagactttttga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
45148611 |
tgtttgagtcgaaggtggattgggaattgatttcgtggaattgtttgatgggtgggtatgtgaagaggaagatgttgggtgatgctaggagactttttga |
45148710 |
T |
|
| Q |
200 |
tcatgtgcttgttagg |
215 |
Q |
| |
|
|||| ||| ||||||| |
|
|
| T |
45148711 |
tcatatgcctgttagg |
45148726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 163
Target Start/End: Original strand, 45164878 - 45165034
Alignment:
| Q |
7 |
gtttttgataacatgctttataaggattccatctcttggaatggattgcttgcagtgtatgttcagaatgggagacttgaggaggctcgtcgattgtttg |
106 |
Q |
| |
|
||||||||||| |||| | | ||| ||||||||||||||||||| | ||||| | |||||||| ||||||||| |||| |||||| ||| ||||||| |
|
|
| T |
45164878 |
gtttttgataatatgcctgaaaagaattccatctcttggaatggccttcttgccgcctatgttcacaatgggagaattgaagaggcttgtctcttgtttg |
45164977 |
T |
|
| Q |
107 |
agtcgaaggtggattgggaattgatttcgtggaattgtttgatgggtaggtatgtaa |
163 |
Q |
| |
|
|||| || ||||||||| |||||||| ||||| |||||||||||| ||| ||||| |
|
|
| T |
45164978 |
agtctaaatcggattgggacttgatttcatggaactgtttgatgggtgggtttgtaa |
45165034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University