View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7697_low_13 (Length: 233)
Name: NF7697_low_13
Description: NF7697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7697_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 190907 - 191116
Alignment:
| Q |
9 |
tgagatgaaggagttgatggatgatgtagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgc |
108 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190907 |
tgaggtgaaggagttgatggatgatatagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgc |
191006 |
T |
 |
| Q |
109 |
aatgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatttacagtcattaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
191007 |
aatgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatttacagtcattaat |
191106 |
T |
 |
| Q |
209 |
taattcatat |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
191107 |
taattcatat |
191116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University