View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7697_low_8 (Length: 272)
Name: NF7697_low_8
Description: NF7697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7697_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 257
Target Start/End: Complemental strand, 33247406 - 33247165
Alignment:
| Q |
15 |
actttggtctttatcgaagtgtactggaatctatctaatggtgaaaaatcatgtaactaccacaagtacaaacctgaataatctagctagtttcatttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33247406 |
actttggtctttatcgaagtgtactggaatctatctaatggtaaaaaatcatgtaactaccacaagtacaaaa-tgaataatctagctagtttcatttgt |
33247308 |
T |
 |
| Q |
115 |
gtgaatatgctttatttattagggaatggtcaattatctagattgaattgaactgaactgtttgctaaactgaatcgaattgtttcaaaccgaatcaaat |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| ||||| |||||||||||||||||| | ||| |
|
|
| T |
33247307 |
gtgaatatgcttcatttattagggaatggtcaaatatctagatcgaattgaactgaactgtttactaaattgaattgaattgtttcaaaccgaaccgaat |
33247208 |
T |
 |
| Q |
215 |
tgttcagagttaaaccgaactgttattactgatgctgttgaag |
257 |
Q |
| |
|
|||| ||| | || ||||| ||||||| |||||||||||||| |
|
|
| T |
33247207 |
tgtttcgagctgaatcgaaccgttattattgatgctgttgaag |
33247165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University