View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7698_low_11 (Length: 299)
Name: NF7698_low_11
Description: NF7698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7698_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 56 - 286
Target Start/End: Complemental strand, 23797905 - 23797675
Alignment:
| Q |
56 |
tcacttgtatgttgttcaacattcaacatttgatccattgtcaaacttctaccaacatttgtttgctaaaactcgatcctatgtatttggggaaaatcgc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23797905 |
tcacttgtatgttgttcaacattcaacatttgatccattgtcaaacttctaccaacatttgtttgctagaactcgatcctatgtatttggggaaaatcgc |
23797806 |
T |
 |
| Q |
156 |
acgaccctacacacaatggctcacaatcttacaaaccctgtagttacaagaatttgatgagattctaaaggtggttgaagcaagaatgttaataatcaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23797805 |
acgaccctacacacaatggctcacaatcttacatacactgtagttacaagaatttgatgagattctaaaggtggttgaagcaagaatgttaataatcaaa |
23797706 |
T |
 |
| Q |
256 |
tctagccctctctccgatcaatgattaaagt |
286 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
23797705 |
tctacccctctctccgatcaatgattaaagt |
23797675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 23797942 - 23797905
Alignment:
| Q |
4 |
attcaacactacatctttatctaaaatctaagcattat |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23797942 |
attcaacactacatctttatctaaaacataagcattat |
23797905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University