View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7698_low_14 (Length: 283)

Name: NF7698_low_14
Description: NF7698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7698_low_14
NF7698_low_14
[»] chr1 (1 HSPs)
chr1 (227-265)||(17991260-17991298)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 17991298 - 17991260
Alignment:
227 gctgcaccaccgatcccatggacgccaccgataccagct 265  Q
    |||||||||||||||||||||||||||||||||||||||    
17991298 gctgcaccaccgatcccatggacgccaccgataccagct 17991260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University