View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7698_low_18 (Length: 233)
Name: NF7698_low_18
Description: NF7698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7698_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 5043736 - 5043547
Alignment:
| Q |
18 |
aagaaagtgctttggtaattcattcactgagctagctagctgtaatatatgtaatgatggcatggggtacatgtgaattaagtagctacaaatgttatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5043736 |
aagaaagtgctttggtaattcattcactgagctagctagctgtaatatatgtaatgatggcatggggtacatgtgaattaagtagctacaaatgttatat |
5043637 |
T |
|
| Q |
118 |
gatttaggaatcatgcaataatattgtaacaacctataaatctaaacaaaagatagataaactacaattttgatgattcatttgctaatctcact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
5043636 |
gatttaggaatcatgcaataatattgtaacaa-ctataaatttaaacaaa----agataaactaaaattttgatgattcatttgttaatctcact |
5043547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University