View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7698_low_21 (Length: 204)
Name: NF7698_low_21
Description: NF7698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7698_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 26 - 191
Target Start/End: Complemental strand, 51350320 - 51350157
Alignment:
| Q |
26 |
agattctactgtgctaaattgacaattgcagtaatatattcaccatcatcatcatgagtgcacattcgcattta-ggtgagtttgatagaatcgcggtgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
51350320 |
agattctactgtgctaaattgacaattgcagtaatatattcaccatcactat---gagtgcacattcgcatttatggtgaatttgatagaatcgcggtgt |
51350224 |
T |
|
| Q |
125 |
gcttctgtgaatttgacagaaactatactttgcagctctaataaaatcaatgtcactgtgatattct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51350223 |
gcttctgtgaatttgacagaaactatactttgcagctctaataaaatcaatgtcactgtgatattct |
51350157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University