View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_high_14 (Length: 389)
Name: NF7699_high_14
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 213 - 374
Target Start/End: Original strand, 25567474 - 25567636
Alignment:
| Q |
213 |
caaatttccccatacctttggaaaa-tgttattttgacatggacaccgtgtgcacttttcatcattattacatcgttaatgtagttcaaatacaatgtta |
311 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25567474 |
caaatttccccatacctttggaaaaatgttattttgacatggacaccgtgtgcacttttcatcattattacatcgttaatgtagttcaaatacaatgtta |
25567573 |
T |
|
| Q |
312 |
attacttttaatagatgatcctatatttgggtttttaacaggaatgaaagtgaggctatcaag |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25567574 |
attacttttaatagatgatcctatatttgggtttttaacaggaatgaaagtgaggctatcaag |
25567636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 3 - 162
Target Start/End: Original strand, 25567263 - 25567422
Alignment:
| Q |
3 |
gagatggacatcataaagaagagtcgtcacttcggatgctgagaaggaactggacaactgcacttcgtgaggcagcagggcttgcagggtttgtagtgct |
102 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25567263 |
gagaaggacattataaagaagagtcgtcacttcggatgctgagaaggaactggacaaccgcacttcatgaggcagcagggcttgcagggtttgtagtgct |
25567362 |
T |
|
| Q |
103 |
ccatttcatgtaattcaacttaattcaagaagtattcattctagcaaacgattttgaaag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25567363 |
ccatttcatgtaattcaacttaattcaagaagtattcattctagcaaacgattttgaaag |
25567422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 102
Target Start/End: Complemental strand, 5149486 - 5149449
Alignment:
| Q |
65 |
cttcgtgaggcagcagggcttgcagggtttgtagtgct |
102 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
5149486 |
cttcgtgaggtagcaggtcttgcagggtttgtagtgct |
5149449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University