View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_high_16 (Length: 376)
Name: NF7699_high_16
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 141 - 360
Target Start/End: Original strand, 372183 - 372400
Alignment:
| Q |
141 |
aattggtggttgcacttgcaccatttaatttaatggttgcgttgcggcataaactagttttccatcacatgacgtgtcccacgtttttattaaaggaaca |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372183 |
aattggtggttgcacttgcatcatttaatttaatggttgcgttgcggcataaactagttttccatcacatgacgtgtcccacgtttttattaaaggaaca |
372282 |
T |
 |
| Q |
241 |
tgaaggcccatgcatacaacgacatgagacagaaaattgttggttcggttggtaataaaattgatgaggagggaagggtaataattctagtttacattta |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| ||||||||||||| |
|
|
| T |
372283 |
tgaaggcccatgcatacaacgacatgagacagaaaattgttggttcggttggtaataaaattgatgag--ggaacgggtaataattttagtttacattta |
372380 |
T |
 |
| Q |
341 |
tctccaaagtttatatatat |
360 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
372381 |
tctccaaagtttatatatat |
372400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 46 - 74
Target Start/End: Original strand, 372088 - 372116
Alignment:
| Q |
46 |
taataattatcctttctaacaacaaaggc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
372088 |
taataattatcctttctaacaacaaaggc |
372116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University