View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_high_19 (Length: 343)
Name: NF7699_high_19
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 179 - 326
Target Start/End: Original strand, 18184254 - 18184401
Alignment:
| Q |
179 |
taataaataagtgaatatgagtttattaactttatttctacttaagattgctcatcttcatccttgatgttgtccattttcatccctttgaatctgaatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18184254 |
taataaataagtgaatatgagtttattaactttatttctacttaagattgttcatcttcatccttgatgttgtccattttcatccctttgaatctgaatc |
18184353 |
T |
 |
| Q |
279 |
aatgccaacaccatttgattctaatttttgttatgatgattcaactaa |
326 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18184354 |
aataccaacaccatttgattctaatttttgttatgatcattcaactaa |
18184401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 18184072 - 18184202
Alignment:
| Q |
1 |
tgatgtattagatagcataaaaagttgatcaaaatttgggtgtctgaataccatgtgtctcgtcagaatttccaactataaaccctttaaaag-nnnnnn |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18184072 |
tgatgttttagatagcataaaaagttgatcaaaatttgggtgtctgaacaccatgtgtctagtcagaatttccaactataaaccctttaaaagttttttt |
18184171 |
T |
 |
| Q |
100 |
natttctatttacctattatttttgaattgg |
130 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
18184172 |
tatttctatttacctattgtttttgaattgg |
18184202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University