View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_high_21 (Length: 328)
Name: NF7699_high_21
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 150 - 312
Target Start/End: Original strand, 10536362 - 10536524
Alignment:
| Q |
150 |
agatatttgagtttcatacatcgttctttcaaacatagtaaaaatgttattatgtgagggtgggtatctagtatgtgttgttttgtcgaacaaagataaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10536362 |
agatatttgagtttcatacatcgttctttcaaacatagtaaaaatgttattatgtgagggtgggtatctagtatgcgctgttttgtcgaacaaagataaa |
10536461 |
T |
|
| Q |
250 |
ctcttttgcatgaagtttgaaaatttcttggatactcttcatacgacagtttttagaagttga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10536462 |
ctcttttgcatgaagtttgaaaatttcttggatactcttcatacgacagtttttagaagttga |
10536524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 10536211 - 10536251
Alignment:
| Q |
9 |
atcatagatcaaagaaatgtaaggacttgaaatggtaaagt |
49 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10536211 |
atcatggatcaaagaaatgtaaggacttgaaatggtaaagt |
10536251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 181
Target Start/End: Complemental strand, 6967141 - 6967113
Alignment:
| Q |
153 |
tatttgagtttcatacatcgttctttcaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6967141 |
tatttgagtttcatacatcgttctttcaa |
6967113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University