View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_low_21 (Length: 375)
Name: NF7699_low_21
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 128 - 358
Target Start/End: Original strand, 38315987 - 38316217
Alignment:
| Q |
128 |
taatcggaactaaaataaacgtaatctcagctcaacaattgaagtttaatctgaactcgaagatgaaaaaattgaaaatcatgttgagagaagagttacg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38315987 |
taatcggaactaaaataaacgtaatctcagctcaacaattgaagtttaatctgaactcgaagatgaaaaaattgaaaatcatgttgagagaagagttacg |
38316086 |
T |
 |
| Q |
228 |
aagttagatcgatgttaccttgctctgatattcgtgaagtgaagtgtgagagagatttggaattttcggtggaatgagaaattgaatggagtggtgaatt |
327 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38316087 |
aatttagatcgatgttaccttgctctgatattcgtgaagtgaagtgtgagagagatttggaattttcggtggaatgagaaattgaatggagtggtgaatt |
38316186 |
T |
 |
| Q |
328 |
tgattttatgtttgaaaagcgtgtgtgaatt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38316187 |
tgattttatgtttgaaaagcgtgtgtgaatt |
38316217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 46
Target Start/End: Original strand, 38315875 - 38315905
Alignment:
| Q |
16 |
attaagctgaataacactcgaaacaaactac |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38315875 |
attaagctgaataacactcgaaacaaactac |
38315905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University