View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_low_24 (Length: 346)
Name: NF7699_low_24
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 10 - 330
Target Start/End: Original strand, 5467695 - 5468015
Alignment:
| Q |
10 |
ggtgttataaatggaaaatgggatggtaatatcccaccagaatgcaaaccaaacccatcaattttaaagctaaatacaaaactcaaatgggaggaagctc |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5467695 |
ggtgttttaaatggaaaatgggatggtaatatcccaccggaatgcaaaccaaacccatcaattttaaagctaaatacaaaactcaaatgggaggaagctc |
5467794 |
T |
|
| Q |
110 |
atgagcctcttcatgcagatatagatgtaggaaaaacttgtggtattggtcccgggcttgcttttgcaaatgaagttgttagaatgagtggtggtgaatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5467795 |
atgagcctcttcatgcagatatagatgtaggaaaaacttgtggtattggtcccgggcttgcttttgcaaatgaagttgttagaatgagtggtggtgaatg |
5467894 |
T |
|
| Q |
210 |
tgttgtgggtcttgttccttgtgcagttggtgggacgagaattgaagagtggagaaatggatcacatttgtataatgaattggtgagaagatctattgaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5467895 |
tgttgtgggtcttgttccttgtgcagttggtgggacgagaattgaagagtggagaaatggatcacatttgtataatgaattggtgagaagatctattgaa |
5467994 |
T |
|
| Q |
310 |
tcggttaaggatggtgatggt |
330 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5467995 |
tcggttaaggatggtgatggt |
5468015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University