View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7699_low_32 (Length: 251)
Name: NF7699_low_32
Description: NF7699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7699_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 19 - 121
Target Start/End: Complemental strand, 12539773 - 12539668
Alignment:
| Q |
19 |
ttattaaccttgacaacattgttgtt---tgcactgaatgtatgttttgcgcacaacagaagtaacaacacagattcaagattactaccgctaccctagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12539773 |
ttattaaccttgacaacattgttgttgtttgcactgaatgtatgttttgcgcacaacagaagtaacaacacagattcaagattactaccgctaccctagc |
12539674 |
T |
|
| Q |
116 |
taaccc |
121 |
Q |
| |
|
|||||| |
|
|
| T |
12539673 |
taaccc |
12539668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 186 - 236
Target Start/End: Complemental strand, 12539610 - 12539560
Alignment:
| Q |
186 |
ctcctttattgtatttgaaaccatatatgaccttcgactctttcacttctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12539610 |
ctcctttattgtatttgaaaccatatatgaccttcgactctttcacttctt |
12539560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 12536336 - 12536383
Alignment:
| Q |
19 |
ttattaaccttgacaacattgttgtttgcactg-aatgtatgttttgc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
12536336 |
ttattaaccttgacaacattgttgtttgtactgtcatgtatgttttgc |
12536383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University