View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7700_high_8 (Length: 232)

Name: NF7700_high_8
Description: NF7700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7700_high_8
NF7700_high_8
[»] chr8 (1 HSPs)
chr8 (11-217)||(329819-330025)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 330025 - 329819
Alignment:
11 gtgagatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
330025 gtgaaatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc 329926  T
111 aatctcctccatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattgcccttatttcatca 210  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
329925 aatctccttcatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattgcccttatttcatca 329826  T
211 tccatat 217  Q
    |||||||    
329825 tccatat 329819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University