View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7700_high_8 (Length: 232)
Name: NF7700_high_8
Description: NF7700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7700_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 330025 - 329819
Alignment:
| Q |
11 |
gtgagatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330025 |
gtgaaatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc |
329926 |
T |
|
| Q |
111 |
aatctcctccatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattgcccttatttcatca |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329925 |
aatctccttcatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattgcccttatttcatca |
329826 |
T |
|
| Q |
211 |
tccatat |
217 |
Q |
| |
|
||||||| |
|
|
| T |
329825 |
tccatat |
329819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University