View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7700_low_11 (Length: 250)
Name: NF7700_low_11
Description: NF7700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7700_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49700071 - 49699835
Alignment:
| Q |
1 |
taggaaggtttaaaaaagattgtactcacatattgcctagttctgcttgtggcatgaacagctaaatttgtcatgtttccaatgatgtatgcagtaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49700071 |
taggaaggtttaaaaaagattgtactcacatattgcctagttctgcttgtggcatgaacagctagatttgtcatgtttccaatgatgtatgcagtaagtc |
49699972 |
T |
 |
| Q |
101 |
cctgattaaagagtatatagaaaatgtcaaatagcatctcccttgtatttacaggatgcagatcaccataaccaactgctgaaacagtgataatggacca |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49699971 |
cctgattaaagagtataaagaaaatgtcaaatagcatctcccttgtatttacaggatgcagatcaccataaccaactgttgaaacagtgataatggacca |
49699872 |
T |
 |
| Q |
201 |
gtatactgatgctacgtagagagacatcgtattcttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49699871 |
gtatactgatgctacgtagagagacatcgtattcttc |
49699835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 184
Target Start/End: Original strand, 2243335 - 2243404
Alignment:
| Q |
115 |
atatagaaaatgtcaaatagcatctcccttgtatttacaggatgcagatcaccataaccaactgctgaaa |
184 |
Q |
| |
|
||||| ||||||||||||| ||| || ||| ||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
2243335 |
atataaaaaatgtcaaatatcatttcatctgtgtttacaggatgcaaatctccataaccaactgttgaaa |
2243404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University