View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7700_low_15 (Length: 231)
Name: NF7700_low_15
Description: NF7700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7700_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 24347184 - 24346982
Alignment:
| Q |
13 |
tagcagagaactgaagtactttggttgaaattatgaacaagggcttgtttgattgaattgttaaattttatggagatcatattcagaaagactatcagtg |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24347184 |
tagcagagaactgaagtactatggttgaaattatgaacaagggcttgtttgattgaattgttaaattttatggtgatcatattcagaaagactatcagtg |
24347085 |
T |
 |
| Q |
113 |
ttcatgagataatttgcccatttcctcattcaacaacattcatgctttacatgaaatataagtttctcttcaaatctatttccaatcctaaacatgaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24347084 |
ttcatgagataatttgcccatttcctcattcaacaacattcatgctttacatgaaatataagtttctcttcaaatctatttccaatcctaaacatgaata |
24346985 |
T |
 |
| Q |
213 |
act |
215 |
Q |
| |
|
||| |
|
|
| T |
24346984 |
act |
24346982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University