View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7700_low_16 (Length: 231)
Name: NF7700_low_16
Description: NF7700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7700_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 420279 - 420474
Alignment:
| Q |
17 |
agacataaatagaaatagacgaaaatgcccttcaagtgaggcacaaaaataagcaatgattgagttgttaaaggggtaatcatgtcatttaaagatcaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420279 |
agacataaatagaaatagacgaaaatgcccttgaagtgaggcacaaaaataagcaatgattgagttgttaaaggggtaatcatgtcatttaaagatcaca |
420378 |
T |
 |
| Q |
117 |
acctgctgcattgctggcagaaccgctgagtcaacccagctgcaacgacggtggctgccttcgagtgaaactcacaaactttgtggcggcggtggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420379 |
acctgctgcattgctggcagaaccgctgagtcaacccagctgcaacgacggtggctgccttcgagtgaaactcacaaactttgtggcggcggtggt |
420474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University