View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7701_high_6 (Length: 257)
Name: NF7701_high_6
Description: NF7701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7701_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 3308046 - 3308265
Alignment:
| Q |
20 |
ctaaacaacagaaatgaacatggatttttgtggttacctctagcagtatcagaaaaatttgaatgaaagtgaagacgagtagcctgaagaatcacagaaa |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308046 |
ctaaacaacaggaatgaacatggatttttgtggttacctctagcagtatcagaaaaatttgaatgaaagtgaagacgagtagcctgaagaatcacagaaa |
3308145 |
T |
|
| Q |
120 |
caccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccatattcactctctctttcactcttccaacaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308146 |
caccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccatattcactctctctttcactcttccaacaac |
3308245 |
T |
|
| Q |
220 |
ttcttcatcaccatcaccat |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3308246 |
ttcttcatcaccatcaccat |
3308265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University