View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7701_low_3 (Length: 415)
Name: NF7701_low_3
Description: NF7701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7701_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 36 - 91
Target Start/End: Complemental strand, 833323 - 833269
Alignment:
| Q |
36 |
catgtatgcagtcttatttttgaacattatatacaagtcaaacaagaattgaaggt |
91 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
833323 |
catgtatgcagtcttatttt-gaacattatatacaagtcaaacaagaattgaaggt |
833269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 206
Target Start/End: Complemental strand, 16741120 - 16741051
Alignment:
| Q |
137 |
tttttataatatttgtgatattcttatgatggtaaccatatgttttgtatgtttttacaaagtaaatttg |
206 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||| | ||||||||||||||| ||| ||| |||| |
|
|
| T |
16741120 |
tttttataatatttgtcatattcttatgatgataaccatgtcttttgtatgtttttataaattaagtttg |
16741051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University