View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7701_low_4 (Length: 348)
Name: NF7701_low_4
Description: NF7701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7701_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 217 - 333
Target Start/End: Original strand, 48963174 - 48963290
Alignment:
| Q |
217 |
gtggtcatttgaaaatattcatattctaattgagtacttcctctcttattattttattttttatagttgattttgtacttcctctaaaataattggtggg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963174 |
gtggtcatttgaaaatattcatattctaattgagtacttcctctcttattattttattttttatagttgattttgtacttcctctaaaataattggtggg |
48963273 |
T |
|
| Q |
317 |
gttgtaaatgttgtttg |
333 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48963274 |
gttgtaaatgttgtttg |
48963290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 72
Target Start/End: Original strand, 48962986 - 48963029
Alignment:
| Q |
27 |
aatatttataagcactaaaaacaaaatttgagaaatttgtaacggt |
72 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
48962986 |
aatatttataagcactaaaa--aaaatttgagatatttgtaacggt |
48963029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University