View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7701_low_8 (Length: 292)
Name: NF7701_low_8
Description: NF7701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7701_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 45212545 - 45212801
Alignment:
| Q |
17 |
aatatcaatttgcagtttgcctatcaacttatgtttttcatcatcaccgctcttctcaaattcgacaaggtcactgattttgccggaagtactaatttcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45212545 |
aatatcaatttgcagtttgcctatcaacttctgtttttcatcatcaccgctcttctcaaattcgacaaggtcactgattttgccggaagtactaatttcg |
45212644 |
T |
 |
| Q |
117 |
taattatcgctgtattgacctttgttatcaaaggctcatggcattttcgacagataatcctcactctatttgttgtaatatggggtcttcgcctcgcctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45212645 |
taattatcgctgtattgacctttgttatcaaaggctcatggcattttcgacagataatcctcactctatttgttgtactatggggtcttcgcctcgcctt |
45212744 |
T |
 |
| Q |
217 |
ctttctcttactcaggattatacaatggggtgaggatagacgctttgatcaaatgcg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45212745 |
ctttctcttactcaggattatacaatggggtgaggatagacgctttgatcaaatgcg |
45212801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University