View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7702_high_13 (Length: 222)
Name: NF7702_high_13
Description: NF7702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7702_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 99 - 205
Target Start/End: Complemental strand, 27078565 - 27078460
Alignment:
| Q |
99 |
tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaatnnnnnnntatgacagaattaaatgtgcgtttttgatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||| |
|
|
| T |
27078565 |
tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaataaaaaaatatgacagaattaaatgcgc-tttttgatat |
27078467 |
T |
 |
| Q |
199 |
tttttgt |
205 |
Q |
| |
|
||||||| |
|
|
| T |
27078466 |
tttttgt |
27078460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 99 - 205
Target Start/End: Complemental strand, 27166630 - 27166525
Alignment:
| Q |
99 |
tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaatnnnnnnntatgacagaattaaatgtgcgtttttgatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||| |
|
|
| T |
27166630 |
tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaataaaaaaatatgacagaattaaatgcgc-tttttgatat |
27166532 |
T |
 |
| Q |
199 |
tttttgt |
205 |
Q |
| |
|
||||||| |
|
|
| T |
27166531 |
tttttgt |
27166525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 27076275 - 27076314
Alignment:
| Q |
121 |
ttgatctagacctatgttatgtatatttcaatgattgaat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27076275 |
ttgatctagacctatgttatgtatatttcaatgattgaat |
27076314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 27078619 - 27078568
Alignment:
| Q |
5 |
gtcgagtgagaagaagatatgaatgac--ctagattatatttcagattcttg |
54 |
Q |
| |
|
||||| || |||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27078619 |
gtcgattgtgaagaagatatgaatgactactagaatatatttcagattcttg |
27078568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 27166684 - 27166633
Alignment:
| Q |
5 |
gtcgagtgagaagaagatatgaatgac--ctagattatatttcagattcttg |
54 |
Q |
| |
|
||||| || |||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27166684 |
gtcgattgtgaagaagatatgaatgactactagaatatatttcagattcttg |
27166633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University