View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7702_low_12 (Length: 249)
Name: NF7702_low_12
Description: NF7702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7702_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 1892579 - 1892816
Alignment:
| Q |
1 |
agctgaaccttttcaatttgtgaactgtcagtcacagttcagtttggttcaatttgatggtttgattttcaatttattttcaacctaaatgtaaccacac |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1892579 |
agctgaacctgttcaatttgtgaactgtcagtcacagttcagtttggttcaatttgatggtttggttttcaatttattttcaacctaaatgtaaccacac |
1892678 |
T |
 |
| Q |
101 |
gtgtctacgtcggtgctacataatatttgccagaatgtgaaaattgacttcctcaattctctcatcatttatatttcataaatgagagcttnnnnnnnta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1892679 |
gtgtctacgtcggtgctacataatatttgccagaatgtgaaaattgactacctcaattctctcatcatttatatttcataaatgagagcttaaaaaattt |
1892778 |
T |
 |
| Q |
201 |
taattctaaaaagtttcagttcataatcctatattcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1892779 |
taattctaaaaagtttcagttcataatcctatattcat |
1892816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University