View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7702_low_14 (Length: 222)

Name: NF7702_low_14
Description: NF7702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7702_low_14
NF7702_low_14
[»] chr4 (5 HSPs)
chr4 (99-205)||(27078460-27078565)
chr4 (99-205)||(27166525-27166630)
chr4 (121-160)||(27076275-27076314)
chr4 (5-54)||(27078568-27078619)
chr4 (5-54)||(27166633-27166684)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 99 - 205
Target Start/End: Complemental strand, 27078565 - 27078460
Alignment:
99 tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaatnnnnnnntatgacagaattaaatgtgcgtttttgatat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||| || ||||||||||    
27078565 tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaataaaaaaatatgacagaattaaatgcgc-tttttgatat 27078467  T
199 tttttgt 205  Q
    |||||||    
27078466 tttttgt 27078460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 99 - 205
Target Start/End: Complemental strand, 27166630 - 27166525
Alignment:
99 tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaatnnnnnnntatgacagaattaaatgtgcgtttttgatat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||| || ||||||||||    
27166630 tggatggatggttttcatgctattgatctagacctatgttatgtatatttcaatgattgaataaaaaaatatgacagaattaaatgcgc-tttttgatat 27166532  T
199 tttttgt 205  Q
    |||||||    
27166531 tttttgt 27166525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 27076275 - 27076314
Alignment:
121 ttgatctagacctatgttatgtatatttcaatgattgaat 160  Q
    ||||||||||||||||||||||||||||||||||||||||    
27076275 ttgatctagacctatgttatgtatatttcaatgattgaat 27076314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 27078619 - 27078568
Alignment:
5 gtcgagtgagaagaagatatgaatgac--ctagattatatttcagattcttg 54  Q
    ||||| || ||||||||||||||||||  ||||| |||||||||||||||||    
27078619 gtcgattgtgaagaagatatgaatgactactagaatatatttcagattcttg 27078568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 27166684 - 27166633
Alignment:
5 gtcgagtgagaagaagatatgaatgac--ctagattatatttcagattcttg 54  Q
    ||||| || ||||||||||||||||||  ||||| |||||||||||||||||    
27166684 gtcgattgtgaagaagatatgaatgactactagaatatatttcagattcttg 27166633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University