View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7702_low_15 (Length: 206)
Name: NF7702_low_15
Description: NF7702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7702_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 43408259 - 43408095
Alignment:
| Q |
19 |
ttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggatttgccctaggcccaatccaccatctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408259 |
ttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggatttgccctaggcccaatccaccatctct |
43408160 |
T |
|
| Q |
119 |
tcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtgcattccatt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408159 |
tcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtgcattccatt |
43408095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University