View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7703_high_17 (Length: 303)
Name: NF7703_high_17
Description: NF7703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7703_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 58 - 210
Target Start/End: Original strand, 28706526 - 28706680
Alignment:
| Q |
58 |
ttcaaccacacttttgagatcaa-tcacaatgcnnnnnnnnnnggtgaattgatgtctcttatccaccaacatagaaaacacaattcaacgaggcctccg |
156 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
28706526 |
ttcaaccacacttttaagatcaaatcacaatgcaaaaaaaaaaggtgaattaatgtctcttatccaccaacatagaaaacacagttcaacatggcctccg |
28706625 |
T |
 |
| Q |
157 |
tattcaagactcgtttataa-caaggaacacacgaatagggagcctatctaagac |
210 |
Q |
| |
|
||||||| |||||| ||||| |||| ||||||| |||||| |||||||||||| |
|
|
| T |
28706626 |
tattcaaaactcgtctataagaaaggttcacacgagtagggatcctatctaagac |
28706680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 289
Target Start/End: Original strand, 28706753 - 28706812
Alignment:
| Q |
232 |
gattccctcccaccatcatctaact--cacatcttttctagtaacaaataacaagatttt |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
28706753 |
gattccctcccaccatcatctaacaaacacattttttctagtaacaaataacaaaatttt |
28706812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University