View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7703_high_21 (Length: 242)
Name: NF7703_high_21
Description: NF7703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7703_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 81 - 223
Target Start/End: Complemental strand, 25027357 - 25027217
Alignment:
| Q |
81 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaagagtgaatcagcttgttgctacttca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25027357 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaag-gtgaatcagcttgttgctacttca |
25027259 |
T |
 |
| Q |
181 |
accatgtgatccctataggtgatgagtaattatatgacagtta |
223 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25027258 |
accatgtgatccctataggtgatgag-acctatatgacagtta |
25027217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 25031964 - 25031889
Alignment:
| Q |
14 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031964 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
25031889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University