View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7703_low_33 (Length: 294)
Name: NF7703_low_33
Description: NF7703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7703_low_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 8921360 - 8921084
Alignment:
| Q |
19 |
tatggggcatgtagagtt-gacggggattagattcattcaactttaggtctttactcacatgcagtgttgctttctatagtgcctgcgccagattgtgtc |
117 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8921360 |
tatggggcatgcagagtttgacggggattagattcattcaactttaggtctttactcacatgcagtgttgctttctatagtgcctgcgccagattgtgtc |
8921261 |
T |
 |
| Q |
118 |
tcttgaagtggagagagataattagtggaggtaattaaatagttaaccgagagattttagagtacttgtgatcactatctcattcgtttaagaattgaat |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8921260 |
tcatgaagtggagagagataattagtggaggtaattaaatagttaaccgagagattttagagtacttgtgatcactatctcattcgtttaagaattgaat |
8921161 |
T |
 |
| Q |
218 |
tatacttgtcattagggatacattacctttaattcagcaaggtgtaatgcatgtctcacctattttacctcaatcgc |
294 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8921160 |
tatacttgtcattagagatacattacctttaattcatcaaggtgtaatgcatatctcacctattttacctcaatcgc |
8921084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University