View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7703_low_43 (Length: 241)
Name: NF7703_low_43
Description: NF7703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7703_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 27091458 - 27091335
Alignment:
| Q |
103 |
cgctggtattggaaagaaatgaaagggtttctttctcactctagtatttatatatcatctctctaaaacatagcatttgacatgtcatccctaagaaata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
27091458 |
cgctggtattggaaagaaatgaaagggtttctttctcactctagtatttatatatcatctctctaaaacatagcatttgagatgtcatccataagaaata |
27091359 |
T |
|
| Q |
203 |
agccaaatcagccctcgatgtcca |
226 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
27091358 |
agccaaatcagccctcaatgtcca |
27091335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 27091544 - 27091508
Alignment:
| Q |
17 |
gaagattgcaatgagcgattgatgtttgttttcctct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27091544 |
gaagattgcaatgagcgattgatgtttgttttcctct |
27091508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University