View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7704_high_19 (Length: 249)
Name: NF7704_high_19
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7704_high_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 108 - 249
Target Start/End: Original strand, 34886225 - 34886365
Alignment:
| Q |
108 |
tttgggtcttggatttggagaaatttctagatccagggcggattcatggacggagatgagttcannnnnnncatccccattgggaatcaagtaggtaaaa |
207 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
34886225 |
tttgggtcatggatttggagaaatttttagatccaggacggattcatgaacggagatgagttcatttttt-catccccattgggaatcaggtaggtaaaa |
34886323 |
T |
 |
| Q |
208 |
cttatccatgttccattgtcataaatcagcataagtatctac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34886324 |
cttatccatgttccattgtcataaatcagcataagtatctac |
34886365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University