View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7704_high_23 (Length: 240)

Name: NF7704_high_23
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7704_high_23
NF7704_high_23
[»] chr3 (1 HSPs)
chr3 (1-224)||(46842569-46842792)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46842792 - 46842569
Alignment:
1 taaaactggattcaatcaattgattgggtctacaaaaagcattgagaaattggatgcatgtcgatgcttttcaaccattgcctttaaacccacccatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46842792 taaaactggattcaatcaattgattgggtctacaaaaagcattgagaaattggatgcatgtcgatgcttttcaaccattgcctttaaacccacccatcaa 46842693  T
101 attcatccctttggctctcgcattggagcttccccctttacgagaaattttgttaccaacagctataaagctatccaattgaggcagtttatgggagttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46842692 attcatccctttggctctcgcattggagcttccccctttacgagaaattttgttaccaacagctataaagctatccaattgaggcagtttatgggagttg 46842593  T
201 gagatggtgttgaaggtgtacttt 224  Q
    ||||||||||||||||||||||||    
46842592 gagatggtgttgaaggtgtacttt 46842569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University