View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7704_low_24 (Length: 247)
Name: NF7704_low_24
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7704_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 41 - 235
Target Start/End: Complemental strand, 13945887 - 13945693
Alignment:
| Q |
41 |
tttggaggcaatggaaaattcatagattatttatgagttgatgttgaacatttatcagattaggtcggttttgcacttgatttccatggtcttggaggac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13945887 |
tttggaggcaatggaaaattcatagattatttatgagttgatgttgaacatttatcagattaggtcggttttgcacttgatttccatggtcttggaggac |
13945788 |
T |
 |
| Q |
141 |
ttcgaggagattctttgtttggagaatcttcaagagaattttcatcctttttgtttgagtgaatttgactctcttcttcatcttcttcaatgatc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13945787 |
ttcgaggagattctttgtttggagaatcttgaagagaattttcatcctttttgtttgagtgaatttgactctcttcttcatcttcttcaatgatc |
13945693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 41 - 235
Target Start/End: Complemental strand, 14087076 - 14086882
Alignment:
| Q |
41 |
tttggaggcaatggaaaattcatagattatttatgagttgatgttgaacatttatcagattaggtcggttttgcacttgatttccatggtcttggaggac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14087076 |
tttggaggcaatggaaaattcatagattatttatgagttgatgttgaacatttatcagattaggtcggttttgcacttgatttccatggtcttggaggac |
14086977 |
T |
 |
| Q |
141 |
ttcgaggagattctttgtttggagaatcttcaagagaattttcatcctttttgtttgagtgaatttgactctcttcttcatcttcttcaatgatc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14086976 |
ttcgaggagattctttgtttggagaatcttgaagagaattttcatcctttttgtttgagtgaatttgactctcttcttcatcttcttcaatgatc |
14086882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University