View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7704_low_25 (Length: 241)
Name: NF7704_low_25
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7704_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 9326433 - 9326211
Alignment:
| Q |
1 |
atatttgttcgaactagcgacgctatcaaggaaaactatctcctaaatttcatcaggagtataggcaaggaagagtggacaaaaatgtggaacaagttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9326433 |
atatttgttcgaactagcgacgctatcaaggaaaactatctgctaaatttcatcaggagtataggcaaagaagagtggacaaaaatgtggaacaagttga |
9326334 |
T |
|
| Q |
101 |
aagaggttgaacatttctttgagtataattttccatctaaggaaggtgatgctgtacaaatgatttggcaagctgtttcacataaagttccttctatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9326333 |
aagaggttgaacatttctttgaatataattttccatctaaggaaggtgatgctgtacaaatgatttggcaagctgtttcacataaagttccttctatgaa |
9326234 |
T |
|
| Q |
201 |
attgaagttaaatagggttagaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9326233 |
attgaagttaaatagggttagaa |
9326211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 44 - 206
Target Start/End: Original strand, 33905209 - 33905371
Alignment:
| Q |
44 |
taaatttcatcaggagtataggcaaggaagagtggacaaaaatgtggaacaagttgaaagaggttgaacatttctttgagtataattttccatctaagga |
143 |
Q |
| |
|
|||| ||||| |||||||| ||||| || || ||||||| ||||||||||| |||||||| |||||| | |||||||| | | | || || |||||||| |
|
|
| T |
33905209 |
taaacttcattaggagtattggcaaagatgaatggacaagaatgtggaacagattgaaagaagttgaaaaattctttgaatttcagttcccttctaagga |
33905308 |
T |
|
| Q |
144 |
aggtgatgctgtacaaatgatttggcaagctgtttcacataaagttccttctatgaaattgaa |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||| ||||||| |||||| ||||| |
|
|
| T |
33905309 |
aggtgatgctgttgaaatgatttggcaagctgtttcacgtaaggttccttttatgaagttgaa |
33905371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University