View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7704_low_30 (Length: 221)
Name: NF7704_low_30
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7704_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 43261660 - 43261861
Alignment:
| Q |
1 |
cccactcttctggtaagccttgtttggtagtcgtaaataattatttctggaatagcttaattcagaatctgatgtaataaataatgaaggctttcaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
43261660 |
cccactcttctggtaagccttgtttggtagtcgtaaataattatttctggaatagcttaattcagaatctgttgtaataaataatgaaggctttcaagag |
43261759 |
T |
 |
| Q |
101 |
agcagcggaatcacttgaaaagcttatggatacagcaagagaggaacttcctgatacaatggctgcaattcgattatctggcatggaaatcagtgactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43261760 |
agcagcggaatcacttgaaaagcttatggatacagcaagagaggaacttcctgatacaatggctgcaattcgattatctggcatggaaatcagtgactta |
43261859 |
T |
 |
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
43261860 |
ac |
43261861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University