View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7704_low_32 (Length: 221)
Name: NF7704_low_32
Description: NF7704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7704_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 37595242 - 37595059
Alignment:
| Q |
17 |
atattctgtagataaacagagtggctatgtccttttttatgcaaatgagagattaatttaggtcacgccatttttggtttttgtcacttacacataaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37595242 |
atattctgtagataaacagagtggctatgtccttttttatgcaaatgagagattaatttaggtcacgccatttttggtttttgtcacttacacataaaat |
37595143 |
T |
|
| Q |
117 |
gccataaaaatcattaaagtatatgttaattgtaaaggaataatggaatcttgtattaaaatatatttaggattgcatgtgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37595142 |
gccataaaaatcattaaagtatatgttaattgtaaaggaataatggaatcttgtattaaaatttatttaggattgcatgtgata |
37595059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University