View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_high_10 (Length: 321)
Name: NF7706_high_10
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 55284591 - 55284302
Alignment:
| Q |
18 |
attgaggtatagttaccatgttagatttgttaagtgcaagaagccttggttgatgaggaagagaaaacggccaggtgtagctattaagacatcaacgccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55284591 |
attgaggtatagttaccatgttagatttgttaagtgcaagaagccttggttgatgaggaagagaaaacggccaggtgtagctattaagacatcaacgccc |
55284492 |
T |
 |
| Q |
118 |
tggtttaaagtatcgagttgagttttttgtcggaagccaccagtgacaagcatagatttgaatggaacaaccccagatttagagattgatcgacaattat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55284491 |
tggtttaaagtatcgagttgagttttttgtcggaagccaccagtgacaagcatagatttgaatggaacaacaccagatttagagattgatcgacaattat |
55284392 |
T |
 |
| Q |
218 |
ggaagacctgagaagctaactcagcagtgggtgcgagtataagaagagtaggagattgtgaagatgatttatgaagtccttgtagttctt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55284391 |
ggaagacctgagaagctaactcagcagtgggtgcgagtataagaagagtaggagattgtgaagatgatttatgaagtccttgtagttctt |
55284302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University