View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_low_11 (Length: 384)
Name: NF7706_low_11
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 32224240 - 32224496
Alignment:
| Q |
19 |
gatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224240 |
gatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtg |
32224339 |
T |
|
| Q |
119 |
aaaggagacaacaacaacgggtcgggtcaacggatccatcatgatcatggttttgttgctgctgcatttggaactgttcataggaagaaaaggatggcta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224340 |
aaaggagacaacaacaacgggtcgggtcaacggatccatcatgatcatggttttgttgctgctgcatttggaactgttcataggaagaaaaggatggcta |
32224439 |
T |
|
| Q |
219 |
ggcaaagaagatcttcatcttctaccatcactattcatctcaaaaatcttccttctt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224440 |
ggcaaagaagatcttcatcttctaccatcactattcatctcaaaaatcttccttctt |
32224496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 298 - 360
Target Start/End: Original strand, 32224525 - 32224587
Alignment:
| Q |
298 |
ctcgcacgtgccaatctctccaattccacctctttttcattctctccctcccgcacgtgtgag |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224525 |
ctcgcacgtgccaatctctccaattccacctctttttcattctctccctcccgcacgtgtgag |
32224587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University